Insulin modulates the expression levels of dopamine b hydroxylase and phenylethanolamine N-methyl-transferase within PC12 cells

Rhodri J. Walters^Y, Manou V. Brandt^Y, Aristotelis Nastos^Y, Naoki Hiroi^Y, Holger S. Willenberg^§Y, Marina K. Oeff^*, Werner A. Scherbaum^§Y, Stefan R. Bornstein^§Y  

From the ^YDepartment of Endocrinology, Heinrich-Heine University Clinic Düsseldorf , Moorenstraße 5, the ^§German Diabetes Research Institute,  University of Düsseldorf, Auf’m Hennekamp 65, D-40225, Düsseldorf, ^*Present address: Department of Dermatology, University Medical Center Benjamin Franklin, The Free University of Berlin, Berlin, Germany.

Summary

Growth factors alter gene expression by modulating transcriptional activity and the prevalence of mature polyadenylated mRNA transcripts.  Presently real-time on-line RT-PCR technology using random hexamers is limited to the quantification of total RNA [1], as a stably polyadenylated pool of a ‘house-keeping’ gene is required for the quantification of mRNA levels when using oligo(dT15) primers [2].  Until recently, the real-time quantification of mRNA levels after oligo(dT15) primed RT of total cellular RNA using 18S rRNA standards was not recommended, as ribosomal RNA transcripts were not believed to be polyadenylated.  As a nascent immature RNA transcript may be processed at many levels [3], and the process of mRNA polyadenylation is believed to be intrinsically coupled to other RNA processing reactions [4], the quantification of polyadenylated RNA species is thought to serve as a measurement of mRNA abundance.  For the first time we present evidence for the polyadenylation of a significant and stable fraction of mammalian 18S rRNA. This demonstration that polyadenylation is not restricted to mRNA species enables the parallel quantification of gene expression at both transcriptional and mRNA levels.  Using the catecholaminergic cascade as an illustration, this method is used to demonstrate that insulin may have a profound modulatory action upon the sympathetic nervous system.  

Key words:  polyadenylation, insulin, catecholamine, 18S rRNA, transcription, real-time PCR

Introduction

Growth factors may regulate gene expression either by altering transcriptional activity or the prevalence of mature polyadenylated mRNA transcripts.  At present however, real-time on-line PCR technology [1] using random hexamers and 18S rRNA internal standards is limited to the quantification of total RNA, making it experimentally difficult for changes in mRNA levels to be quantified following oligo(dT15) primed RT [RT, 2]. Thus at present real-time on-line RT-PCR quantification of mRNA levels using 18S internal standards following the oligo(dT15) primed RT of total cellular RNA is not ‘recommended’ as (1) levels of polyadenylation of transcripts may vary and, (2) mammalian rRNAs are not believed to be polyadenylated.  A nascent immature RNA transcript may subsequently be processed at many levels, including the variable splicing of introns, the use of alternative splice acceptor sites, the addition of a 5’m7GpppG cap, or the variable use of polyadenylation sites and RNA editing [3].  The process of mRNA polyadenylation itself is believed to be coupled to other RNA processing reactions [4].  These, and other post-transcriptional mechanisms, combine to alter the size, relative abundance and stability of mature mRNA species.  

In contrast eukaryotic 25S, 18S, and 5.8S rRNAs are synthesized as a single transcript with two internal transcribed spacers (ITS1 and ITS2), which are subsequently removed by endo- and exoribonucleolytic steps to yield mature rRNA.  Thus the processing of ribosomal rRNA is held to be fundamentally distinct in nature from that of mRNA.  In E.Coli one factor that is believed to distinguish between ‘stable’ RNA species, such as tRNA and rRNA, and ‘unstable’ RNA species such as mRNA is 3’ polyadenylation, long considered a specific feature of mRNA and a few other unstable RNA species [2].

However, recent data from E.Coli suggests that polyadenylation is not unique to mRNA, and its widespread occurrence suggests that it may serve a more general function in RNA metabolism [5]. There have been reports of polyadenylation of non mRNA species in simple unicellular organisms, such as 25S rRNA in Candida albicans [6] and of 5S rRNA in Chlamydomonas chloroplasts [7].  The strongest evidence to date for the polyadenylation of a higher eukaryotic rRNA comes from a 28S rRNA retropseudogene which had a long A-rich tract at its 3'-end bounded within palindromic repeats [8]. Here the real-time quantitative PCR technique is exploited to show that a small but significant  fraction of 18S rRNA is stably polyadenylated in PC12 cells and rat brain.  This finding permits 18S to be used as an internal standard in the parallel real-time quantification of both total RNA and mRNA levels.

It was originally observed that following RT with oligo(dT15), conventional 18S PCR primers gave a product around 180 bases in length, close to the size of the predicted amplicon for 18S rRNA (Fig.1a).   However, as no polyadenylation of mammalian 18S rRNA was believed to occur, this necessitated further verification.  Thus a forward sense primer was used in conjunction with oligo(dT15) for conventional 3’ RACE RT-PCR cloning, using cDNA derived from both rat brain mRNA (Stratagene) and total RNA derived from serum-starved PC12 cells.  The resulting 0.75kb RT-PCR product was cloned and sequenced, and subsequent BLAST search analysis employed to verify that18S rRNA had indeed been amplified. The polyadenylation of 18S rRNA is only useful in real-time PCR provided that the level of polyadenylation is not modulated by any of the experimental conditions employed.  This was addressed by measuring and comparing the Ct values obtained with the internal 18S standard for RTs performed with identical concentrations of random hexamer and oligo(dT15) from 1µg of total RNA from the same series of agonist stimulations (table 1).  The DCt values (Ct_dT15 – Ct_random) were statistically invariant, with the maxima and minima not differing significantly (n=4), and thus the fraction of 18S rRNA that is polyadenylated can be regarded as being constant.

The effects of growth factors upon the expression of both mRNA and total RNA levels of tyrosine hydroxylase (TH), dopamine b hydroxylase (DBH) and phenylethanolamine N-methyl-transferase (PNMT) were determined by this new method.  At the level of both total RNA and mRNA TH expression levels were significantly augmented by both NGF (50ng/ml) and PACAP-38 (100nM), but not by insulin (100nM; Fig.2A,B).  PACAP-38 significantly augmented DBH mRNA levels, and to a greater extent than total RNA levels (P<0.01).  Although insulin appeared to be without significant effect upon DBH total RNA levels, at the mRNA level, insulin significantly depressed DBH levels (53.8 ± 8.8 %, P<0.01, CI).  PACAP-38 significantly augmented the total RNA expression level of PNMT (201 ± 20 %, P<0.01, Fig.2E), but not at the mRNA level.  Insulin in contrast significantly inhibited PNMT expression at both total and mRNA levels. 

For the first time we present evidence for the stable polyadenylation of a small, yet substantial fraction of the 18S rRNA pool.  The purpose and nature of this polyadenylation is not clear, and neither is the mechanism.   However, the finding illustrates that polyadenylation is not a phenomenon restricted to mammalian mRNA species.  It is possible that the polyadenylated fraction represents a subset of 18S rRNA with a unique subcellular localization or function, but at present this remains mere conjecture.  What is however clear, is that this stably-regulated pool of polyadenylated 18S rRNA allows the parallel study of gene expression quantitatively at two levels, firstly, at the level of transcription and secondly at the level of the mature, processed and polyadenylated mRNA transcript. 

Here we have used this new method to study the effects of known polypeptide modulators of the PC12 cell upon the expression profile of the enzymes of the catecholaminergic cascade (CCAC).  Here the technique is employed to show that whilst PACAP-38 upregulates PNMT expression at the transcriptional level, this is not realized at the mRNA level, and conversely, whilst insulin appears to have no significant effect upon DBH total RNA expression, it significantly depresses DBH mRNA levels.  Further, from a purely quantitative perspective it can be seen that PACAP-38 exhibits a significantly greater augmentation of DBH mRNA levels than of total RNA.  Thus, the two may not necessarily be correlated and should thus be determined in parallel to obtain a more complete understanding of the process of gene regulation.

In addition to their ability to change the electrical properties of neurons, evidence suggests that growth factors are able to alter the cell's neurotransmitter metabolism and thereby its phenotype.  The phenotype is thus thought to be labile, particularly during development, and may be directed, and later modulated, by the cell’s environment.  Disorders of functional expression the catecholaminergic cascade have been implicated in many disorders of mood, mind, motion and emotion, such as schizophrenia, bipolar disorder and Parkinson’s [10].

Adrenal chromaffin cells, sympathetic neurons and small intensely fluorescent (SIF) cells are believed to develop from a common sympathoadrenal progenitor, whose differentiation is determined at least in part by the relative levels of nerve growth factor (NGF) and glucocorticoid within its environment [11].  Thus in addition to choosing between neuronal and neuroendocrine fates, sympathoadrenal progenitors are ultimately directed to express an appropriate neurotransmitter phenotype whether it be dopaminergic (e.g. substantia nigra), noradrenergic (e.g. locus coeruleus) or adrenergic (adrenal chromaffin cell).  Sympathetic neurons also have the potential to become either noradrenergic or cholinergic. The partially dedifferentiated PC12 pheochromocytoma cell thus serves as a good model through which to study the effects of growth and matrix factors upon the expression profiles of the cells of the sympathoadrenal lineage, as it retains the capacity to express all three rate-limiting enzymes of the catecholaminergic cascade (CCAC), including PNMT.  

For adrenal chromaffin cell differentiation to occur necessitates two sequential, glucocorticoid-dependent events, firstly the inhibition of neuronal differentiation and, secondly, the induction of epinephrine synthesis [11].  Our observations suggest that PACAP-38, a polypeptide released within the adrenal medulla [12], also induces PNMT total RNA expression, but that a second factor, possibly a glucocorticoid, is necessary for a stable increase in PNMT mRNA levels to occur.  Indeed, physiological concentrations of glucocorticoids abolish NGF-induced neurite outgrowth from isolated adrenal chromaffin cells, thus stabilizing the chromaffin cell phenotype [13].  The observations that NGF and ECM (which also induces neurite outgrowth) both inhibit PNMT expression, and therefore the appearance of the rounded adrenergic chromaffin cell phenotype, suggests that growth factors act differentially at multiple levels throughout the CCAC to arrest the ‘transmitter phenotype’ of the cell at an appropriate point.  This is most clearly illustrated by NGF and ECM, which either alone or in combination, potently induce neurite outgrowth in the PC12 cell line.  NGF and ECM together induce TH expression strongly, as shown both here and previously [14], but inhibit both DBH and PNMT expression, thus promoting the dopaminergic phenotype.  In contrast PACAP-38 upregulates the expression of all three CCAC enzymes under our experimental conditions, as shown previously in chromaffin cells [15,16].

This is the first report that insulin inhibits both DBH and PNMT expression.  If this were to be manifested at the level of enzymatic activity, then this would suggest that conditions such as hyperinsulinaemia, diabetes mellitus and anorexia nervosa may have profound effects upon the sympathetic nervous system. Although the effects of insulin have not yet been extensively studied, it is interesting to note that insulin-like growth factor-I upregulates TH, DBH and PNMT mRNA levels [17], in contrast to the actions of insulin.  If these data can be extrapolated in vivo, then prolonged elevations in insulin levels might be predicted to reduce aggression, and alter adrenomedullary responses and mood.

For the first time we present evidence for the stable polyadenylation of a significant fraction of mammalian 18S rRNA.  This demonstrates that polyadenylation is not restricted to mRNA species, but further enables the parallel quantification of gene expression at the levels of transcription and mRNA.  Using the catecholaminergic cascade as an illustration, the differential regulation of gene output at the level of transcription and mRNA processing can now be quantified. This method may help to explain existing discrepancies between real-time PCR measurements using random hexamers and microarray profiling of mRNA levels.

Materials and Methods

Cell culture

PC12 cells were plated at 25-30% confluence in 1% fetal calf serum (FCS) RPMI 1640 medium and left for 24 hours to adhere in T75 flasks (Nunc) coated with either 500µl 10% ECM matrix (Matrigel, Sigma) in DMEM or 200µl collagen type I (3mg/ml in 1mM acetic acid, Sigma).  Cells were washed twice with 12ml of pre-warmed (37°C) serum-free 1% bovine serum albumin (BSA) RPMI 1640 and serum-deprived for 2 hrs prior to stimulation with 1% BSA RPMI with or without NGF (50ng/ml, Gibco), PACAP-38 (100nM, Sigma) or insulin (100nM, Gibco).  Flasks were washed with 12ml DMEM and incubated for 10 minutes at 37°C with 6ml DMEM containing 0.5% BSA and  6 U collagenase (Serva).  The cells were washed with D-PBS and pelleted by centrifugation prior to lysis with 700µl of RA1 buffer.  Isolation of total cellular RNA was carried out using a Macherey-Nagel Nucleospin RNA II kit according to manufacturer’s specifications, including a 15 minute DNAse I treatment.

Reverse transcription

RNA concentration was determined through an A₂₆₀ measurement in a spectrophotometer and a volume equivalent to 1µg of RNA was taken for RT primed either by random hexamers or oligo(dT15) (Roche).  The desired volume of RNA was supplemented to a total volume of 17µl with diethylpyrocarbonate-treated water (Gibco), and to this was added a pre-prepared reaction mix containing avian moloney virus (AMV) reverse transcriptase 2µl, 4µl of 10x AMV reaction buffer, 8µl of 25mM MgCl₂ stock, 4µl 10mM dNTP mix, 4µl primers (oligo(dT15) or random hexamers, 0.02 U/µl), 1µl RNAse inhibitor (all Roche) to a total reaction volume of 40µl.  The reverse transcrition was performed in a Biometra T3 Thermocycler with the temperature cycling program: 10 minutes at 25°C, 2 hours at 42°C, 5 minutes at 99°C, with subsequent cooling to –3°C.

Quantitative Real-Time PCR

The cDNA of interest is added to a PCR reaction mixture containing standard PCR components, i.e. the forward and reverse primers, plus a TaqMan® probe that anneals to the template between the two primers. Real-time PCR was conducted under identical conditions with equivalent 3µl volumes of cDNA to which was added a prepared reaction mix containing (per reaction) 25µl of TaqMan® mastermix (Applied Biosystems), 5µl of 10µM forward primer stock (final concentration 1µM), 5µl of 10µM reverse primer stock (1µM), 2.5µl of 2µM TaqMan® 6-FAM primer (0.1µM) all targeted against the gene of interest; with 0.25µl of forward, reverse and TaqMan® VIC primers directed against the 18S gene [9] reconstituted to a total volume of 50µl with sterile water.  Reactions were performed in a 96 well reporter plate in singulate so as to allow two sets of 32 reactions to be performed in parallel using cDNA derived from both oligo(dT15) and random hexamer primed RT's under identical reaction conditions.  Signals were compared to non-template controls in which identical reaction constituents were added without cDNA to determine baseline noise.  The TaqMan® primer sequences used were: rat tyrosine hydroxylase – 1027FWD TGT TGG CTG ACC GCA CAT, 1088REV GGC CCC CAG AGA TGC AA and TaqMan® probe 1046T 5’ FAM-TGC CCA GTT CTC CCA GGA CAT TGG-TAMRA-3’; rat PNMT 340FWD GAG TCC TGG CAG GAG AAA GAA C, rat PNMT 407REV TGC ACA TCA ATG GGC AAG A, rat PNMT probe 365T 5’ FAM-CGC TTC ACC CTC GCT CGG AGC T-TAMRA-3’; rat DBH 438F CAG CCT ATC CCT GCT CTT CAA, rat DBH 510R AGT GTC ATC CTC AAT GAC ATA ATC CT, rat DBH probe 460T 5’ FAM-AGG CCC TTT GTC ACC TGC GAC CC-TAMRA-3’.  The 18S sequences are the copyright of  Applied Biosystems (Foster City, CA).  The reaction cycle consisted of a 50°C step for 2 minutes, a second stage step to 95°C for 10 minutes, followed by 50 cycles consisting of 15 seconds at 95°C and 1 minute at 60°C.

The PCR cycle (Ct) number at which the fluorescence reaches a threshold value of 10 times the standard deviation of baseline emission, or noise, is used for quantitative measurement. Data were calculated as means ± SE from 4 replicate culture experiments. Real-time RT-PCR data was analyzed by ANOVA and the two-tailed Students’ paired T-test assuming unequal variance.   Significance was assumed when P<0.05 in both tests.

18S rRNA cloning

Conventional PCR was performed using cDNA prepared by oligo(dT15) primed RT from rat brain and serum-starved PC12 cells as previously described.  Reactions were performed using (sense) 18S FWD primer 5‘-GTA ACC CGT TGA ACC CCA TT-3’ in conjunction with either 18S REV 5‘-CCA TCC AAT CGG TAG TAG CG-3’ or oligo(dT15) as the reverse primer [Accession No. K03432; Transcript +1718 - +1868, predicted amplicon 0.150 kb], with a reaction mixture containing 2µl forward primer (0.4µmole), 2µl reverse primer (0.4µmole), 2µl cDNA, 25µl Taq Master mix (Roche) and 19µl sterile water with the following reaction time course: 2 min 95°C; 5 cycles of 95°C for 30 sec, 57°C for 2 min, 72°C for 3 min, followed by 35 cycles of 94°C for 30 sec, 55°C for 2 min and 72°C for 3 min, with a final extension at 72°C for 10 min prior to cooling to 4°C using a Perkin Elmer 9700 GeneAmp.

PCR products were run on a 2% agarose TAE gel and bands were excised under UVA illumination and eluted from agarose using a Qiagen QIAquick gel extraction kit.  The PCR product was ligated into a pCR4-TOPO cloning vector and used to transform TOP10 chemically competent E.coli according to the manfacturer’s recommendations (Invitrogen TOPO TA Cloning Kit).  Transformants were spread upon an agar selection plate (containing ampicillin 50mg/L) using an X-gal substrate to verify plasmids containing PCR inserts.  Five colonies were selected for mini-prep amplification and sequencing using M13 forward primers. Insertion was verified by parallel mini-preps using an EcoRI restriction endonuclease digestion of the ligated insert for subsequent agarose gel analysis.  Sequences were determined for at least two clones to allow for the high Taq mutation rate (0.63% in these experiments), and from both strands of the plasmid DNA using M13 forward and reverse primers.

References

[1] Freeman, W.M., Walker, S.J., Vrana, K.E. Quantitative RT-PCR: pitfalls and potential. Biotechniques 26(1), (1999)  112-22

[2] Bustin, S.A. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction analysis. J Mol Endocrinol. 2, (2000) 169-93

[3] Staton, J.M., Thomson, A.M., Leedman, P.J. Hormonal regulation of mRNA stability and RNA-protein interactions in the pituitary. J Mol Endocrinol 25(1), (2000) 17-34

[4] Minvielle-Sebastia, L., Keller, W. mRNA polyadenylation and its coupling to other RNA processing reactions and to transcription  Curr Opin Cell Biol 11(3), (1999) l352-7.

[5] Li, Z., Pandit, S., Deutscher, M.P. Polyadenylation of stable RNA precursors in vivo.  Proc Natl Acad Sci U S A.13;95(21), (1998) 12158-62.

[6] Fleischmann, J., Liu, H. Polyadenylation of ribosomal RNA by Candida albicans. Gene 7:265(1-2), (2001) 71-6.
[7] Komine, Y., Kwong, L., Anguera, M.C., Schuster, G., Stern, D.B. Polyadenylation of three classes of chloroplast RNA in Chlamydomonas reinhadtii.  RNA 6(4), (2000) 598-607

[8] Wang, S, Pirtle, I.L., Pirtle, R.M. A human 28S ribosomal RNA retropseudogene.  Gene 1;196(1-2), (1997) 105-11.

[9] Schmittgen, T.D. Zakrajsek, B.A. Effect of experimental treatment on housekeeping gene expression: validation by real-time, quantitative RT-PCR. J Biochem Biophys Methods. 20;46(1-2), (2000) 69-81.

[10] Mallet, J. The TiPS/TINS lecture. Catecholamines: from gene regulation to neuropsychiatric disorders. Trends Pharmacol Sci 17(4), (1996) 129-35

[11] Anderson, D.J. Cell fate determination in the peripheral nervous system: the sympathoadrenal progenitor.  J Neurobiol  24(2),185-98

[12] Moller, K., Sundler, F. Expression of PACAP and PACAP type I receptors in the rat adrenal medulla.  Regul Pept 63(2-3), (1996) 129-39

[13] Unsicker, K., Krisch, B., Otten, U., Thoenen, H. Nerve growth factor-induced fiber outgrowth from isolated rat adrenal chromaffin cells: impairment by glucocorticoids. Proc Natl Acad Sci U S A 75(7), (1978) 3498-502.

[14] Badoyannis, H.C., Sharma, S.C., Sabban, E.L. The differential effects of cell density and NGF on the expression of tyrosine hydroxylase and dopamine beta-hydroxylase in PC12 cells. Brain Res Mol Brain Res 11(1), (1991) 79-87

[15] Tonshoff, C., Hemmick, L., Evinger, M.J. Pituitary adenylate cyclase activating polypeptide (PACAP) regulates expression of catecholamine biosynthetic enzyme genes in bovine adrenal chromaffin cells. J Mol Neurosci 9(2), (1997) 127-40

[16] May, V., Braas, K.M. Pituitary adenylate cyclase-activating polypeptide (PACAP) regulation of sympathetic neuron neuropeptide Y and catecholamine expression.  J Neurochem 65(3), (1995) 978-87

[17] Hwang, O., Choi, H.J. Induction of gene expression of the catecholamine-synthesizing enzymes by insulin-like growth factor-I. J Neurochem 65(5), (1995) 1988-96

Fig. 1.   Conventional RT-PCR employing a reverse oligo(dT15) primer amplifies the 18S rRNA sequence. a, 2% agarose gel showing 18S RT-PCR products generated from 2µl of cDNA from an oligo(dT15) primed reverse transcription (see methods).  Lane 1. Serum-starved control (ss-con) PC12 (no growth factor) + 18S FWD and 18S REV primers.  Lane 2.  Rat brain with 18S FWD + 18S REV.  Lane 3. ss-con PC12 with 18S FWD + oligo(dT15). Lane 4. Rat brain with 18S FWD + oligo(dT15).  Lane 5, Marker, ladder VI (Roche) with lengths (bp) 2176, 1766, 1230, 1033, 653, 517, 453, 394, 298, 234/220 and 154.  b, Alignment of fragment of cloned sequence (upper alignment), after corrections for Taq errors, with known sequence for rat 18S rRNA gene (Genbankä accession number gi 206631, lower alignment).

Figure 2.  Effects of the growth factors Nerve Growth Factor (NGF, 2.5S), PACAP-38 and insulin (INS) upon total RNA (A,C,E) and mRNA (B,D,F) expression levels for TH (A,B), DBH (C,D) and PNMT (E,F).  Values are given as means ± standard error after normalization to 18S levels in 4 experiments.  Data are presented relative to values obtained for collagen type I without added growth factor.  Statistical significance was determined by the students t-test method, with (*) P<0.05, (**) P<0.01 and (***) P<0.001.

Table 1. Ct values determined using 18S TaqMan® (VIC) primers obtained from 4 paired sets of experiments using both oligo(dT15) and random hexamer primed reverse transcription.  Data are presented as means ± standard error.

B

1    cggctaccacatccaaggaaggcagcagagcgcgcaaattacccactcccgacccgggga

     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

463  cggctaccacatccaaggaaggcagcagagcgcgcaaattacccactcccgacccgggga 

61   ggtagtgacgaaaaataacaatacaggactctttcgaggccctgtaattagaatgagtc 

     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

522  ggtagtgacgaaaaataacaatacaggactctttcgaggccctgtaattggaatgagtc 

121  cactttaaatcctttaacgaggatccattggagggcaagtctggtgccagcagccgcggt 

     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

581  cactttaaatcctttaacgaggatccattggagggcaagtctggtgccagcagccgcggt

181  aattccagctccaatagcgtatattaaagttgctgcagttaaaaagctcgtagttggatc 

     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

641  aattccagctccaatagcgtatattaaagttgctgcagttaaaaagctcgtagttggatc 

241  ttgggagcgggcgggcggtccgccgcgaggcgagtcaccgcccgtccccgccccttgcct

     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

701  ttgggagcgggcgggcggtccgccgcgaggcgagtcaccgcccgtccccgccccttgcct

301  ctcggcgccccctcgatgctcttagctgagtgtcccgcggggcccgaagcgtttactttg

     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

761  ctcggcgccccctcgatgctcttagctgagtgtcccgcggggcccgaagcgtttactttg

361  aaaaaattagagtgttcaaagcaggcccgagccgcctggataccgcagctaggaataatg

     ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||

821  aaaaaattagagtgttcaaagcaggcccgagccgcctagataccgcagctaggaataatg

421  gaataggaccgcggttctattttgttggttttcggaactgaggccatgattaagagggac 

     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

881  gaataggaccgcggttctattttgttggttttcggaactgaggccatgattaagagggac 

481  ggccgggggcattcgtattgcgccgctagaggtgaaattcttggaccggcgcaagacgga 

     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

941  ggccgggggcattcgtattgcgccgctagaggtgaaattcttggaccggcgcaagacgga 

541  ccagagcgaaagcatttgccaagaatgttttcattaatcaagaacgaaagtcggaggttc 

     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

1001 ccagagcgaaagcatttgccaagaatgttttcattaatcaagaacgaaagtcggaggttc 

601  gaagacgatcagataccgtcgtagttccgaccataaacgatgccgactggcgatgcggcg 

     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

1061 gaagacgatcagataccgtcgtagttccgaccataaacgatgccgactggcgatgcggcg 

Figure 1

Figure 2